X
تبلیغات
فروشــــگاه پرندگان

قالب پرشین بلاگ


فروشــــگاه پرندگان
خرید و فروش و آموزش نگهداری پرندگان
به طور کلی قناریها نسبت به سایر پرندگان کمتر دچار بیماری می شوند ، پرنده ای که جای مناسب داشته باشد و به خوبی تغذیه و نگهداری شود ، به ندرت نیازی به دارو و درمان دارد .
مسلما به عنوان یک اصل کلی ، پیشگیری بهتر از درمان میباشد لذا ضروری است که با اهم نکاتی که در پیشگیری از بیماریها اهمیت دارند ، آشنا شویم .
- تیزی و سرزندگی پرنده ، پرهای نرم و مرتب و چشمان شفاف از نشانه های یک پرنده سالم است لذا میباید مراقب هرگونه آشفتگی در پرها و یا بیحالی قناری بود معمولا اختلال در حفظ دمای بدن ، مشکلات تنفسی مانند پخ پخ کردن و بی اشتهایی از نشانه های اولیه بیماری در قناری است . پف کردن قناری ، کاهش وزن و تحلیل رفتن عضلات سینه ، نشاندهنده وخامت بیماری بوده و احتمال از بین رفتن پرنده است.
- در مصرف نادرست داروهای مختلف امکان داردکه عامل بیماری زا دارای مقاومت گشته و دیگر به هیچ آنتی بیوتیکی حساس نباشد .
- درمان ناقص بوسیله مصرف اشتباه داروها ، موجب عدم درمان یا مسمومیت دارویی میشود و احتمال انتقال بیماری به سایرین را فراهم میکند .
- پرنده بیمار را در محل گرم و جدا از سایرین نگهداری کنید .
- اصول و موازین بهداشتی را همواره رعایت کنید و توجه نمایید که برخی بیماریها درمان ندارند .
- پرندگان تازه خریداری شده را به دامپزشک نشان دهید .
- از مدفوع پرندگان تازه خریداری شده تحت نظر دامپزشک آزمایش بعمل آید.
- پرندهای تازه خریداری شده حدود بیست روز یا حداقل یک هفته در قرنطینه نگهداری و با انجام بازرسی صحیح آنها ، تحت کنترل دقیق قرارگیرند .
- عدم دسترسی موش و سایر جوندگان به غذا یا محیط نگهداری قناری و از بین بردن جوندگان .
- مراقبت از قناری و ایجاد آرامش برای جلوگیری از آسیب دیدگی و بروز جراحت در بدن پرنده بخصوص در ناحیه پا ، لازم است سطوح تیز و اشیا برنده در قفس قناری قرار نگیرد . عدم برخورد قناری با دیوار وشیشه درصورت آزاد بودن پرنده درمحل نگهداری .
- ممانعت از تراکم زیاد قناری ها در قفس .
- استفاده از غذاهای مناسب و متنوع و عدم مصرف دانه های مانده و کپک زده و کاهش رطوبت مواد خوراکی .
- استفاده از واکسن آبله و سایر واکسن ها مانند واکسن بیماری نیوکاسل .
- نظافت مداوم قفس قناری بخصوص توجه اساسی به تعویض لانه های ویژه تخم گذاری .
- عدم استفاده خودسرانه و بی رویه از مصرف داروهای مختلف خصوصا در طولانی مدت .
- حفظ رطوبت محیط نگهداری قناری ( توجه شود که محیط نگهداری نه خیلی خشک و نه خیلی مرطوب باشد. )
- هنگام مصرف مواد خوراکی مرطوب مانند میوه ها باقیمانده آنها را از قفس خارج نموده و قفس را نظافت نمایید .
- غذاهای مرطوب مانند میوه جات را قبل از مصرف در یخچال نگهداری کنید .
- حفاظت محیط نگهداری از لحاظ وجود پشه ، کرم خاکی ، سوسک ، کنه و شپش و ضد عفونی محل و انجام سایر اقدامات برای از بین بردن آنها .
- استفاده از توری در اطراف محیط نگهداری به منظور جلوگیری از حضور پشه وسایر حشرات .
- جلوگیری از تماس پرنده با مدفوع گربه و سایر گربه سانان .
- عدم تماس قناری با حیوانات وحشی بخصوص پرندگان وحشی .
- عدم قرار گرفتن طولانی مدت قناری در معرض تابش مستقیم نور خورشید .
- جلو گیری از آسیب دیدگی قناری توسط وسایل گرما زا .
- استفاده از مقادیر کافی ویتامین آ در جیره غذایی برای جلوگیری از کوری قناری .
- جلوگیری از جفت گیری قناریهای هم خانواده .
- توجه به احتمال مسمومیت به لحاظ خوردن رنگ قفس و همچنین روزنامه کف قفس قناری .
- توجه به احتمال مسمومیت قناری بوسیله گاز بخاریهای بدون دود کش .
- توجه به احتمال مسمومیت بوسیله سموم گیاهی یا دامی .
- قرار دادن و در دسترس بودن کف دریا و سنگ ریزه در قفس نگهداری قناری .
- جلوگیری از کمبود ویتامین ها و مواد معدنی درجیره غذایی .
- مصرف بی رویه ویتامین ها بخصوص ویتامین های محلول در چربی شامل ویتامین آ ، د ، ای ، کا می تواند موجب مسمومیت در قناری شود .
- توجه به اثرات نامطلوب تغییر ناگهانی جیره غذایی مانند ایجاد بی اشتهایی یا کم اشتهایی و همچنین بوجود آمدن بیماری یبوست .
- استفاده از سبزی و میوه جات در جیره غذایی قناری .
- عدم مصرف میوه و سبزی در هنگام ابتلا قناری به بیماری اسهال .
- توجه به نور محیط نگهداری برای پیشگیری از پرخوری یا پرکندن قناری .
- استفاده از دانه منداب در جیره غذایی بخصوص برای قناری های ماده .
- استفاده از برنامه غذایی مناسب در هنگام تولک به منظور تامین موادمعدنی و ویتامین های مورد نیاز بدن قناری و پیشگیری از کاهش توان تولید مثل و آوازخوانی .
- کنترل رژیم غذایی قناری در دوران تولک به منظور جلوگیری از چاق شدن پرنده .
[ ] [ ] [ مهرداد ]

روش پیشنهادی برای جفت اندازی قناری (به ترتیب انجام اقدامات لازم ) انتخاب جفت مناسب بارعایت رابطه خویشاوندی ، تناسب رنگ و نزاد و هدف از تکثیر کسب اطمینان از سلامت و شادابی قناریهای انتخاب شده کسب اطمینان از آمادگی قناری ماده ( بیقراری و جیک زدن پیاپی ، جمع آوری کاغذ درگوشه های قفس ، کندن پراز بدن خود و سایرپرندگان و داشتن پس دوکی شکل ) کسب اطمینان از آمادگی قناری نر ( آواز خوانی قرص و بیقراری در قفس ) تقویت قناری ماده در مدت بیست روز قبل از جفت اندازی با استفاده از مکمل های غذایی و مولتی ویتامین حاوی مقادیرلازم ویتامین A , E تقویت قناری نر در مدت بیست روز قبل از جفت اندازی با استفاده از مکمل های غذای و مولتی ویتامین حاوی مقادیرلازم ویتامین A , E قراردادن قفس مخصوص جوجه کشی در محل مناسب از لحاظ رعایت دما ، نور و جلوگیری از استرس قرار دادن قناری ماده در قفس جوجه کشی قراردادن لانه مخصوص تخم گذاری تغذیه قناری ماده با غذای مقوی تخم مرغی بصورت یکروز در میان در طول یک هفته قبل از جفت اندازی قرار دادن قفس قناری نر در کنار قفس قناری ماده در مدت یک هفته قبل از جفت اندازی ورود قناری نر به داخل قفس قناری ماده کسب اطمینان از مناسب بودن وضعیت لانه تخم گذاری



[ ] [ ] [ مهرداد ]

علل عدم موفقيت در جوجه كشي قناري ها :

الف - عدم آماده سازي قناري هاي نر وماده براي جفت گيري وامتناع آنها از جفت گيري .
ب – جفت گيري موفق قناري هاي نر وماده ولي عدم تشكيل نطفه در تخم ها .
ج – جفت گيري موفق قناريهاي نروماده همراه با تشكيل نطفه در تخم ها ولي مرگ جنين در داخل تخم ويا ظرف چند روز پس از خروج از آن .
عوامل موثر در آماده سازي قناريها براي جفت گيري :
1- وجود بيماريهاي مزمن در بين پرندههاي نر وماده .
2- عدم تغذيه صحيح در دوران تو لك وپس از آن .
3- مصرف آنتي بيوتيكها وموادشيميايي مضر .
4- عدم رعايت محدوديت جوجه كشي در فصل جفت گيري يا به عبارتي جوجه كشيدن بيش از توان قناري ها در فصل قبل .
5- وجود سموم قارچي ناشي از كپك زدگي در دان .
6- رعايت نكردن برنامه صحيحي روشنايي با افزايش تدريچي مدت طول روشنايي در طي 24 ساعت .
7- كهولت سن يا عدم بلوغ جنسي پرنده

[ ] [ ] [ مهرداد ]

برای يک شخص مبتدی مشکل ترِن و مهمترِين کار در وهله اول شناختن جنسيت پرنده  است. از اين لحاظ به خريداران و علاقه مندانی که تازه می خواهند قناری ابتياع کنند توصيه می شود که در اين مورد با فروشنده با تجربه و قابل اطمينان وارد معامله شده و  متذکر شوند تا در صورت تشخِص اشتباه بتوانِيد پرنده را تعويض نمائيد.  همان طور که گفته شد تشخيص نر يا ماده بودن پرنده کار آسانی نيست اما بين جنس نروماده قناری اختلافاتی وجود دارد که نياز به تجربه و دقت کافی دارد.  اگر قناری نر لال نباشد بهترين دليل وجه تمايز برای تعيين جنسيت آواز خواندن قناری است.قناری ماده هم ممکن است آواز بخواند اما آواز آنها قدرت چندانی ندارد و به صورت منقطع ودارای لرزش می باشد ليکن متاسفانه در هنگام ضرورت وسيله ای نيست که پرنده را وادار به آواز خواندن نمود می بايست به موارد ذيل بيشتر توجه نمود.



در نرهای آماده جفت گيری ناحيه مخرج برجسته و دارای چين های مختصری است که در پرنده ماده وجود ندارد.



چشمان قناری نر دارای جلای بيشتری می باشد که نشان دهنده شجاعت و اعتماد به نفس است که در ماده کمتر است .



حرکات ماده عموما کند ترو کمتر از نرهاست به اصطلاح قناری نر دارای شادابی وتحرک بيشتری است.



جمجمه قناری نر در قسمت فوقانی کمی پهـن تر از جنس ماده می باشد.



رنگ آميزی پرهای قناری نر زيبا تر و شفاف تر از رنگ ماده ميباشد.



درقناریهای نر بالغ زیر منقار پرهایش کمی پف کرده است.



قناری نر دارای چثه بزرگتری نسبت به ماده می باشد.



قناریهای ماده منقار روشنتری نسبت به نرها دارند.

[ ] [ ] [ مهرداد ]
ویتامین B
برای برقراری تعادل عصبی و نظم سوخت و سوز بدن ضروری است .
آثار کمبود ویتامین : کمبود این ویتامین در بدن باعث اختلال در دستگاه گوارشی و اعصاب می شود و ممکن است موجب روماتیسم شود .
منابع ویتامین : این ویتامین در سیر - زرده تخم مرغ - جگرسیاه - لبنیات .
ویتامین B1
در تنظیم اعمال تنفسی وعصبی و زدودن اختلالات عصبی موثراست .
آثار کمبود ویتامین : کبود این ویتامین باعث آماس روده -بیماری بری بری - گرفتگی عضلات - بی اشتهائی میشود .
منابع این ویتامین : این ویتامین در مخمرجو - تخم مرغ - لبنیات یافت میشود .
ویتامین B2
مهمترین عامل در رشد بدن است .
آثار کمبود ویتامین : باعث لاغری - توقف رشد -اختلالات تنفسی - بیماریهای پوستی -اختلالات گوارشی میشود .
منابع ویتامین : این ویتامین در اسفناج - شیر - سفیده تخم مرغ -آب جو یافته میشود .
ویتامین B6
در سوخت وسوز مواد گلوسیدی و غذا موثر است .
آثار کمبود ویتامین : باعث کم خونی - ضعف اعصاب - ودرد شکم میشود .
منابع این ویتامین : این ویتامین در جوانه گندم - ذرت - سبزی ها - برنج - زرده تخم مرغ - سیب زمینی یافت میشود .
ویتامین B12
در کم خونی ورفع عوارض عصبی موثر است .
آثار کمبود ویتامین : باعث کم خونی و ضعف میشود .
منابع این ویتامین : این ویتامین در زرده تخم مرغ وپسته یافت میشود .
ویتامین C
در تنظیم عمل بافتها وایجاد مقاومت در بدن بسیار موثر است .
آثار کمبود ویتامین : باعث خون ریزی جلدی - ضعف شدید - درد عضلات - رخوت و سستی - نارسی های اعمال بدن میشود .
منابع این ویتامین : این ویتامین در لیمو - پرتقال - جعفری - کاهو - گوجه فرنگی - سیب زمینی یافته میشود .
ویتامین D
در رشت وسفت شدن استخانها موثر است .
آثار کمبود ویتامین : باعث نرم شدن و کج شدن استخانها میشود .
منابع این ویتامین : این ویتامین در روغن ماهی - زرده تخم مرغ - نارنج و نور آفتاب یافت میشود .
ویتامین E
این ویتامین باعث تقویت اعضای تناسلی میشود .
آثار کمبود ویتامین : باعث عقیم شدن پرنده میشود .
منابع این ویتامین : این ویتامین در جگر سیاه - زرده تخم مرغ - موز - جوانه گندم - کاهو - کلم - روغن بادام زمینی - کره یافت میشود .
ویتامین F
در رویش پرها ولطافت آنها موثر است .
آثار کمبود ویتامین : باعث ایجاد زخمهای جلدی و اختلالات در هضم غذا و پوست پوستی شدن بدن میشود .
منابع این ویتامین : این ویتامین در روغن ماهی - جوانه گندم - اسیدهای غیر اشباع یافته میشود .
ویتامین H
باعث تقویت صدا و خوش آوازی میشود .
آثار کمبود ویتامین : باعث ایجاد مشکلات پوستی و مشکلات خواندن میشود .
منابع این ویتامین : این ویتامین در سبوس کندم - زرده تخم مرغ - جگر سیاه یافت میشود .
ویتامین K
مهمترین ویتامین برای انعقاد خون است .
آثار کمبود ویتامین : باعث خون ریزی - ورم روده -طولانی شدن زمان انعقاد خون میشود .
منابع این ویتامین : این ویتامین در حبوبات - گوجه فرنگی - سیب زمینی یافت میشود .
ویتامین P
آثار کمبود ویتامین : باعث خون ریزیهای زیر جلدی میشود .
منابع این ویتامین : این ویتامین در سبزی ها - لیمو - پرتقال - لبنیات - سیب زمینی یافت میشود .
ویتامین PP
باعث تقویت دستگاه گوارشی میشود .
آثار کمبود ویتامین : باعث بیماری پلاکر میشود .
منابع این ویتامین : این ویتامین در  جگر سیاه - سیب زمینی - نخود یافت میشود .
اگر پرنده ای این ویتامین ها را به طور کامل در بدن داشته باشد و ما با دستو غذائی مناسب این ویتامین ها را در اختیار او قرار دهیم هیچ موقع مریض نشده وطول عمر زیادتری خواهد داشت
[ ] [ ] [ مهرداد ]
 غذاهائی که موقع تولکی برای قناری خوبه عبارتند از:



1-     جوپرک رو مقداری در آسیاب خورد کرده البته خیلی پودر نشه مقداری دون دون بمونه بعد بادام درختی رو رنده می کنیم اسیاب نکنید بعد به این صورت که عرض میکنم  ترکیب کنید:2قاشق مربا خوری جو .1قاشق بادام  درآخر مقداری تخم خرفه بپاشید روش حالا به تعداد قناری ها مقداری درست کنید که به همه مقدارکمی برسه.این غذا رو هفته ای یک بار تکرار کنید.

2-     گشنیز رو خوب شسته خشک کنید در هفته دو بار به قناری بدهید.

3-     کاهو رو خوب شسته خشک کنید در هفته دو بار به قناری بدهید.

4-     سعی کنید درصد تخم کتان از تخم ارزن بیشتر باشد نسبت به دوران مستی قناری.

5-     آبتنی رو هفتهای سه بار برای قناریها مهیا کنید.

6-     مولتی ویتامین هر 15 روز یک بار برای قناریها گذاشته شود.

7-     بلال شیرین هر 2هفته یک بار برا ی قناریها گذاشته شود.
[ ] [ ] [ مهرداد ]

پس از مطمئن شدن از آمادگي قناري نر و ماده هر دوي آنها را بايد در يك قفس پهلوي هم قرار داد. در چند روز اول ممكن است به نظر آيد كه با يكديگر جنگ مي كنند اما اين علامت خوبي است كه حكايت از جفت خوردن آنها است.


چنانچه مشاهده شود كه ماده قناري اقدام به كندن پرهاي سينه خود مي كند و يا پنبه و چيزهاي ديگري را در قفس جمع مي كند ،‌ موقع آن رسيده كه اقدام به لانه گذاري در قفس شود.
اغلب قناريها با گذاشتن اولين و بعضي با گذاشتن چهارمين تخم ، لانه سازي را به پايان مي رسانند. بنابراين اگر وسايل لانه سازي زودتر در قفس قرار داده شود ، قناري پس از تمام كردن لانه ، دوباره آن را خراب مي كند و مجددا آن را مي سازد . اين عمل ممكن است در بعضي از قناريها موجب بي حوصلگي و خستگي شود و لانه ي نامرتب و نامنظمي داشته باشند.
اگر مشاهده شود كه قناري لانه خوبي نمي تواند بسازد بهتر است در ساختن لانه به او كمك شود.
در مدتي كه قناري نر و ماده پهلوي هم هستند و تا قبل از تخم گذاري بايد هفته اي يكي دو بار به آنها غذاي تخم مرغي و يا همطراز آن داده شود. اما همين كه زمان تخم گذاري ماده قناري فرا رسيد بايد غذاي تخم مرغي قطع شود.


تعداد تخم قناري از 2 تا 8 عدد متغيير مي باشد. اما به طور معمول 4 عدد مي باشد. قناري ماده معمولا بين ساعت 6 تا 7 صبح اقدام به تخم گذاري مي كند. معمولا قناري تخمهاي خود را پشت سر هم و هر روز يكي از آنها را مي گذارد.


تخمهاي اول تا سوم بهتر است برداشته شود و بجاي آن تخم مصنوعي و يا تخمهاي خراب شده از لانه هاي قبل قرار داده شود و در عصر روز سوم كه تخم چهارم گذاشته مي شود همه آنها را به لانه برگردانده و تخمهاي مصنوعي از لانه خارج شود. براي برداشتن و قرار دادن تخم ها در لانه بهتر است از يك قاشق چايخوري استفاده شود تا به پوسته ظريف تخم ها صدمه اي وارد نشود.
پس از اينكه آخرين تخم گذاشته شد بهتر است لانه براي آخرين بار مرتب شود و به گوشه و زير لانه داروي ضد كنه قناري با احتياط پاشيده شود .

معمولا 14 تا 15 روز طول مي كشد تا جوجه ها از تخم بيرون آيند. در اين مدت بايد غذاي ساده و هفته اي يكبار نيز غذاي تخم مرغي به قناري داده شود.
بعضي اوقات پرده داخلي تخم قناري به علت گرما و خشكي هواي اتاق به اندازه اي خشك مي شود كه جوجه قناري قادر به پاره كردن آن نمي باشد و در نتيجه نخواهد توانست تا از تخم بيرون آيد و تلف خواهد شد.


بعضي اوقات نيز نصف بدن جوجه از تخم خارج شده ولي به علت پرده خشك شده خلاصي جوجه به طور كامل از تخم عملي نمي شود در اين موقع برس كوچكي از پشم شتر را بايد در آب گرم فرو برده و با آن پرده داخلي تخم را تر نمود.

براي جلوگيري از اين پيشامد در روزهاي آخر ، همه روزه بايد قدري آب به كف اتاق قناريها پاشيده شده و يا يك ملافه خيس در آن آويزان كرد.


از صبح روز چهاردهم بايد منتظر خروج اولين جوجه از تخم باشيد. چنانچه تا عصر روز چهاردهم شكافي در تخمها مشاهده نشد بايد از تخمها امتحان به عمل آيد تا از خراب نشدن آنها مطمئن شويد.
امتحان تخم قناري به اين ترتيب صورت مي گيرد:


يك ورقه مقوا را كه يك طرف آن سياه رنگ باشد را برداشته و سوراخي _ كمي تنگ تر از قطر تخم قناري _ در آن ايجاد نماييد. اين ورقه را در دست چپ به طوري كه شست در طرف سياه آن قرار گيرد نگاه ميدارند سپس تخم قناري را با انگشت شست و سبابه دست راست برداشته و در مقابل سوراخ مقوا ، در برابر روشنايي نگاه داشته و به داخل آن نگاه كنيد. اگر تخم شفاف باشد دليل بر اين است كه تخم نطفه نداشته و اگر لك يا نقطه هاي تيره داشته باشد علامت آن است كه تخم به علتي فاسد شده است. اگر تخم سياه و حاجب ماوراء بود حتما داراي جوجه مي باشد. اين تخمهاي جوجه دار را به لانه بازگردانيد و تا صبح روز پانزدهم منتظر بمانيد. اگر تا آن موقع هم تخمها به حال خود باقي ماندند با يك چوب سر تيز و يا ته سوزن در سر پهن تخم ، يك سوراخ كوچك ايجاد نماييد و آن را به لانه بازگردانيد. يكي دو ساعت صبر كنيد . اگر پيشرفتي در سوراخ ايجاد شده در تخم حاصل نشد آنرا در امتداد نوك جوجه ، توسعه دهيد تا تمام نوك ظاهر شود و مجددا آن را به لانه بازگردانيد تا جوجه خودش را آزاد نمايد.


تخمي كه جوجه زنده يا مرده در آن دارد چنانچه در ظرف آب قرار دهيد ، تا نصفه در آب فرو مي رود. و اگر آنرا در روي سطح صافي قرار دهيد بر خلاف جاذبه زمين بر روي سر نوك تيز خود مي ايستد.
به هر حال بايد به اين نكته توجه كرد كه تا جايي كه ممكن است اجازه دهيم تا خود جوجه از تخم خارج شود و در صورت نياز تنها با سر پهن تخم جوجه عملي را انجام داد و هرگز با سر نوك تيز تخم ،كاري انجام ندهيم.


برچسب‌ها: نمونه لانه های قناری و نحوه لانه سازي و تخم گذاري
[ ] [ ] [ مهرداد ]
درباره تاريخ ورود قناری به ايران اطلاع دقيقی در دست نيست . البته بايد گفت اروپائيان
در زمان صفويه به ايران رفت و آمدهايی داشتند و پرتغاليها که از دريانوردان آن زمان بودند
حتی جزاير جنوب ايران را در اختيار گرفته بودند . اين تقريبا کمی بعد از پيدايش و رواج
قناری در اروپا بوده است . با اين حال هيچ نشانه ای از وجود قناری در دوره ی صفويه در
دست نيست . گرچه بعيد می نمايد که قناری در آن سالها به ايران وارد شده باشد . اگر چنين
اتفاقی نيز افتاده باشد حتما بر اثر عدم اطلاع کافی در نگهداری آن از بين رفته اند .
اولين تاريخی که از ورود قناری به ايران ذکر شده به دوران قاجاريه و زمان ناصرالدين
شاه است. ناصرالدين شاه تقريبا اولين پادشاهی بود که مسافرتهای زيادی در عصر خود به
اروپا و کشورهای خارج کرد . می گويند پس از سفر انگلستان در هلند ميهمان ملکه هلند بود
و هنگام بازگشت به ايران تعداد بيست عدد قناری همراه ملازمی مخصوص برای نگهداری
آنها از آن کشور وارد کرد.


پس از او معير الممالک اقدام به ورود قناری می نمايد و به اين ترتيب پرورش قناری در
ميان اعيان و اشراف رواج پيدا می کند . منتها تعداد قناری از تعداد اعيان و اشراف کمتر بود.
گر چه مدارک مستدلی دال بر صحت مطالب فوق وجود ندارد ولی اين گفته بهر صورت خالی
از حقيقت نيز نمی تواند باشد.چه در ميان بسياری اين نکته که قناريهای قديمی ايران هلندی
بوده اند اتفاق نظر وجود دارد.


قناری مسکوئی بايد همراه مهاجرين ايرانی از روسيه پيش از انقلاب کمونيستی در آن
کشور به آذربايجان و تبريز و بعد از آن در دوران انقلاب مشروطيت که رفت و آمدهای بين
دو کشور افزايش يافت به ايران رسيده باشد.


در آن اوان قناری سبز و ابلق کم بود و اصولا به آن گنجشکی می گفتند . لفظ قناری
مخصوص زرد و طلائی يا ليموئی آن بود . همچنانکه امروزه در زبان فارسی هنگاميکه کلمه
قناری برزبان رانده شود در ذهن همه ی شنوندگان ، بی اختيار پرنده ای زرد کشيده ، صاف و
دلنشين تداعی می گردد.


در اوايل دوره ی پهلوی يعنی شايد حدود ١٣١٠ شخصی به نام حسن سيلاخوری قناری
طلائی کشيده و پابلند در ضمن صدادار برای اولين بار بوجود آورد و در اين باب نيز شهرتی
کسب کرد. شخص ديگری موسوم به سيد تقی خان لاريجانی نيز توانست قناريهايی کشيده و
صدادار فردار البته به رنگ ليموئی به وجود آورد. علی خان خوراک پز از جفت کردن
قناری ماده سيد تقی خان با يک قناری لال نر طلائی سيلاخوری موفق شد جوجه هايی پر صدا
و ساده به دست آورد که نه تنها در زمان خود شهرت و آوازه ای کسب کرد ، بلکه هم چنان
امروزه نيز قناری علی خانی زبانزد خاص و عام است و قناريهای صدادار را به قناريهای
علی خانی نسبت می دهند.


مشخصات و خصوصيات قناری :
به خانواده فينچ ها ( Passeres) پرنده ای از رسته گنجشکها ( Serinus ) قناری
در جزاير ( Serinus Canaria canaria) تعلق دارد . قناری وحشی ( Fingi llidae)
زندگی می کند . اين قناری از اغلب انواع ( Azoren) و آزورن ( Medeira) ماديرا
پرورشی کوچک تر بوده و طولش از منقار تا انتهای دم حدود ١٣ سانتيمتر است .
پرهای زرد خاص انواع اهلی ، در انواع پرورشی نيز يافت شده ولی شديدا با رنگهای
سبز زرد ، سبز و سياه مخلوط می باشد.ماده ها رنگ آميزی مات تری نسبت به نر ها داشته و
با نوع آفريقائی خويشاوندی ( Serinus Serinus ) خاکستری قهوه ای هستند.قناری اروپايی
نزديک دارد . آنها را می توان با هم جفت کرد و ماحصل آنها نيز تکثير پذير هستند .
زيستگاه طبيعی اين پرندگان کوچک مراتع سرسبز ، مزارع ميوه و دامنه هائی است که
دارای رستنی های اندکی هستند . در طبيعت منابع تغذيه بيشماری برای پرندگان وجود دارد
که گردآوردن آن برای پرنده ای در قفس کاری بس دشوار است . اين منابع از بسياری گياهان
و علفها از قبيل خانواده چليپائيان ، کانيها ، خشخاش و ارزن گرفته تا کرمها و نوزادان پروانه
ها همه نقش اساسی را در تغذيه حيوان به عهده می گيرند .
در حاليکه برای پرنده ايکه در قفس به سر می برد همه اختيارات در دست نگهدارنده آن
است و چيزی بيشتر از آنچه که در اختيارش گذارده می شود نمی تواند برگزيند .
در مورد آواز پرندگان وحشی و مقايسه آن با آواز انواع اهلی اختلاف عقيده وجود دارد .
برخی را عقيده بر آن است که اهلی ها خوش آواز ترند و عده ای ديگر عقيده ای عکس آن
را دارند .


زمان جفت گيری قناريها ی وحشی در وطنشان در محدوده اواسط بهمن تا اواسط فروردين
ماه آغاز می شود . در اين ماهها آواز نوع نر شدت می يابد .در اين زمان پرواز و جهش های
مخصوص جفت گيری همانگونه که در قناريهای اهلی مشاهده می شود ، به چشم می خورد
( آواز لاينقطع همراه با پرواز بين شاخه درختان ). به محض يافتن يک ماده آماده جفت و
جفت شدن ، ماده شروع به ساختن لانه خواهد کرد . برای اين منظور دو شاخه ای را نزديک
به تنه درختی در ارتفاع دو تا سه متر انتخاب می کند . لانه از اجزاء گياهان ، علوفه و مواد
نرم ديگر ساخته شده و داخل اين محيط نرم تا پنج تخم گذارده می شود .
قناريهای ماده به تنهايی سيزده روز تمام روی تخمها خواهند خوابيد .نوع نر در اين فاصله
تغذيه ماده را به عهده می گيرد . والدين هر دو در پرورش جوجه نقشی به عهده می گيرند .
معمولا در يکسال ٢ و حتی ٣ بار تخم گذاری و جوجه کشی انجام می شود . با مستقل شدن
جوجه های نوبت آخر، قناريها تشکيل گروههای بزرگی داده و برای پيدا کردن خوراک ،
زمستان را در اطراف جزاير قناری به جستجو می پردازند .


مرگ و مير قناريهای جوان بسيار زياد است . در حد فاصل تولد و روز استقلال کامل ،
فاصله زمانی پر مخاطره ای وجود دارد . تنها تعداد کمی به سن يکسالگی می رسند . البته اين
امر در پرندگان کوچک غير عادی نمی باشد . زنده ماندن والدين و دو تا از جوجه ها برای
بقاء نسل کافی است .


دشمنان قناری بسيارند ؛ پرندگان شکارچی ، پستانداران شکارچی و مارها از دشمنان
درجه اول نوزادان می باشند . بسياری نيز در اثر بدی آب و هوا در کوتاه مدت و يا سوانح
اولين پرواز به دام مرگ خواهند افتاد . از نظر رفتار شناسی قناری اصولا پرنده ای چندان
اجتماعی نيست . جفت به هنگام جفت گيری و تخم گذاری دارای منطقه مشخصی بوده و تحمل
قناری ديگری را در آن ندارد. اما پس از آن در پائيز ، پير و جوان تشکيل گروههای بزرگی
را می دهند . اين گروهها تنها در زمستان پايدار بوده و بيشتر تجمعی حفاظتی در مقابل
دشمنان می باشند . در زمان جفت گيری نيز هر کس جفت مطلوب را نيافت مانند برخی
قناريهای وحشی می تواند يکسال را بدون خانواده سپری کند . نتيجه آنکه شايد قناری ايده آل
ترين جانوران خانگی باشد ، زيرا بدون نگرانی درباره سرحال بودنش ، می توان مدتی
تنهايش گذارد . البته اين بدان معنی نمی باشد که همه چيز برای قناری بی تفاوت است .
جانوران هر قدر هم که غير اجتماعی باشند به برخی پديده های اطراف خو گرفته و از
آنها ياد می گيرند . قناری به زودی تشخيص خواهد داد که چه کسی به او آب و دانه ميدهد .
چه کسی به او دانه لذيذ می دهد و چه کسی همدم اوست . پرنده نياز به هيجان و تحول دارد .
بدين ترتيب بيدار، سرحال و نکته سنج می شود . لذا نزديکی شما با قناری بسيار مطلوبش
خواهد بود (مشروط بر اينکه با صدای ميز و يا صدای بلند تلويزيون موجب وحشت وی
نگرديد) .
اما رابطه نزديکی نظير آنچه بين مرغ عشق و انسان پديد می آيد ، هرگز بين انسان و
قناری به وجود نخواهد آمد .

[ ] [ ] [ مهرداد ]
تعیین جنسیت اغلب پرندگان تا زمان بلوغ و حتی گاهی بعد از بلوغ امری نسبتا مشکل است. اما جنسیت پرندگان و سایر جانوران از بدو تشکیل نطفه، به لحاظ ژنتیکی معین است. امروزه با پیشرفت روش های مولکولی، تعیین جنسیت جانداران در هر مرحله از زندگی میسر می باشد. در تحقیق حاظر تعیین جنسیت در قناری با استفاده از واکنش PCR و براساس دو ژن CHD-W و CHD-Z شرح داده شده است. در این تحقیق جمعا از 29 قطعه قناری استفاده شد. استخراج DNA از انتهای کالاموس پر قناری های زنده صورت پذیرفت و با استفاده از پرایمرهای اختصاصی طراحی شده در این طرح، واکنش PCR تنظیم گردید. نتایج نشان دهنده تکثیر دو قطعه DNA به طول های 345 و 306 جفت باز برای جنس ماده و فقط یک باند 306 جفت باز برای جنس نر بود. این نتایج برای کلیه نمونه های پر مشاهده شد. از آنجا که طراحی این سیستم تعیین جنسیت برای اولین بار در قناری مورد استفاده قرار می گیرد و نتایج مولکولی با ویژگی های مورفولوژیک دو جنس نر و ماده کاملا مطابقت دارد، لذا تعیین جنسیت جوجه های قناری با انجام واکنش PCR روی نمونه های پر، آسان، سریع، بی خطر و ارزان می باشد.


مقدمه:
قناری ها (Serinus canaria canaria) از جمله زیباترین پرندگان خانگی هستند که از زمان های بسیار دور نگهداری آنها به خاطر آواز دلنشین و رنگ آمیزی زیبایشان رایج شده و مورد توجه مردم سراسر دنیا قرار گرفته است. طبق دسته بندی سیستماتیک زیست شناسی، قناری وحشی به راسته گنجشک ها (Passeriformes) و به خانواده فنچ ها (Fringillidae) تعلق دارند. با توجه به اینکه قناری ها از زمان بلوغ شروع به آواز خواندن می کنند و صدای زیبای قناری ها بیشتر توسط جنس نر تولید می شود، به همین دلیل جنس نر این پرنده نسبت به جنس ماده از لحاظ اقتصادی دارای ارزش بیشتری است و با قیمت افزون تری نسبت به جنس ماده به فروش می رسد (1، 2و 3). یکی از بهترین راه ها برای تمایز دادن پرندگان نر و ماده استفاده از روشهای مولکولی بر اساس DNA است. یافتن یک نشانگر مولکولی مناسب برای تعیین جنسیت، کاری دشوار است. از آنجا که ژنوتیپ پرنده ماده ZW و ژنوتیپ پرنده نر ZZ می باشد، لذا کروموزوم W فقط در جنس ماده پرندگان وجود دارد و بر اساس آن می توان مارکر ژنتیکی مناسبی برای تفکیک جنس های نر و ماده از هم یافت. این ویژگی همانند کروموزوم Y در انسان است با این تفاوت که در انسان و سایر پستانداران، جنس نر هتروگامتیک است و جنس ماده هموگامتیک می باشد ولی در پرندگان وضعیت دقیقا عکس است (4و5). برخی از ژنهای موجود بر روی کروموزوم W بسیار حفظ شده بوده و با استفاده از این گونه ژن ها می توان در تمام گونه های پرندگان، جنسیت پرنده را با استفاده از یک جفت پرایمر و طی یک مرحله انجام واکنش PCR تعیین کرد (6). در برخی از پرندگان، نظیر پرندگان عظیم الجثه مانند شترمرغ، پرایمرهای مربوط به ژن CHD، سبب تکثیر قطعاتی در هر دو ژن CHD-W و CHD-Z می گردد زیرا این پرایمر ها همزمان با هم قسمت های هومولگ از ژن CHD-W و ژن مرتبط آن یعنی CHD-Z را تکثیر می نمایند اما در این قطعات تکثیر شده، تفاوت طول مشاهده می گردد و از همین خاصیت می توان به منظور تعیین جنسیت پرندگان بهره گرفت (7و8). هدف از این تحقیق تنظیم روش PCR برای تعیین جنسیت قناری برای اولین بار با پرایمرهای جدید طراحی شده می باشد.


مواد و روش کار:
به منظور تعیین جنسیت قناری جمعا از 29 قطعه قناری نمونه گیری به عمل آمد. نمونه گیری از انتهای کالاموس پر قناری های زنده (11 ماده و 6 نر و12 جوجه قناری با جنسیت نامعلوم) صورت گرفت و‌DNA ی ژنومی با استفاده از روش استاندارد فنل-کلروفرم استخراج گردید و جهت اطمینان از کیفیت DNA و مشاهده قطعات DNAی استخراج شده از ژل آگارز 1 درصد و رنگ آمیزی توسط اتیدیوم برماید استفاده شد، همچنین کیفیت DNA استخراج شده توسط دستگاه اسپکتروفوتومتر نیز بررسی گردید. به منظور انجام PCR، نیاز به پرایمرهای اختصاصی تعیین جنسیت می باشد که بر اساس ژن CHD قناری طراحی گردند. اما پس از انجام مطالعات بسیار، توالی ژن CHD قناری یافت نشد لذا به منظور طراحی پرایمر از توالی ژن CHD-W مربوط به پرنده ای با نام علمی Hemispingus frontalis که از خانواده Fringillidae می باشد و قرابت فیلوژنتیکی بالایی با Serinus canaria دارد، استفاده شد. توالی پرایمرهای طراحی شده برای این تحقیق به صورت زیر است:



Canary-F: 5'- GGATGAGGAACTGTGCAAAAC -3'

Canary-R: 5'- AATAGTTCGCGGTCTTCCAC -3'

برای انجام واکنش PCR حجم نهایی واکنش 25 میکرولیتر بوده که شامل: 20 نانوگرم DNA الگو، 2 میلی مولار MgCl2، 25 پیکومول از هر پرایمر، 1 واحد آنزیم DNA پلیمراز Taq و200 میکرو مولار dNTP Mix بود. برای انجام واکنش PCR از دستگاه مسترسایکلر گرادینت شرکت Eppendorf استفاده شد. برنامه ی حرارتی مورد استفاده شامل: 95 درجه سانتی گراد 5 دقیقه، سپس 30 چرخه دمایی به ترتیب 94 درجه سانتی گراد 1 دقیقه، 58 درجه سانتی گراد 1 دقیقه و 72 درجه سانتی گراد 1 دقیقه و یک مرحله نهایی 72 درجه سانتی گراد 5 دقیقه تنظیم گردید. سپس محصولات PCR با ژل آگارز 5/1 درصد الکتروفورز گردید و توسط اتیدیوم برماید رنگ آمیزی شد و با استفاده از نور UV مورد ارزیابی قرار گرفت.

 
نتایج و بحث:
از کالاموس پر پرندگان مورد آزمایش، DNAی ژنومی با موفقیت استخراج گردید و کیفیت DNA ی استخراج شده با استفاده از روش طیف سنجی و الکتروفورز روی ژل آگارز 1 درصد تعیین گردید. سپس غلظت DNA استخراج شده به میزان ng/μl 20 تنظیم شد. انجام PCR با پرایمرهای اختصاصی طراحی شده ی تعیین جنسیت در قناری و مشاهده ی نتایج حاصل بر روی ژل آگارز 5/1 درصد نشان دهنده تکثیر دو قطعه DNA به طول های 345 و 306 جفت باز برای جنس ماده و یک باند 306 جفت باز برای جنس نر بود که در ژل آگارز مشاهده می شود.
نتایج حاصل نشان می دهد، تعیین جنسیت قناری با استفاده از این روش، بسیار سریع، دقیق و کم هزینه بوده و در هر دوره از زندگی این پرنده می تواند بکار رود. از آنجایی که تعیین جنسیت پرندگان با استفاده از روش های قدیمی مانند لمس کلواک، سنجش میزان استروئید، کاریوتایپینگ و... دشوار و زمانبر می باشد و حتی در برخی موارد موجب مرگ پرنده می شود(9) لذا محققین متعددی تا کنون در راستای تعیین جنسیت مولکولی موجودات تلاش نموده اند و برخی نیز به نتایج مطلوبی دست یافته اند. برای مثال در سال 1998 Griffiths و همکاران با استفاده از دو ژن CHD-W و CHD-Z و طراحی پرایمر های متعدد، به تعیین جنسیت گروهی از پرندگان (شتر مرغ، قو، کبوتر، غاز وحشی و ...) پرداخته اند (10). در سال 2000، Nesje و همکاران سعی کردند با استفاده از دو جایگاه میکروستلایتی، پرندگانی از قبیل شاهین، باز وحشی، قوش و غیره را تعیین جنسیت نمایند اما این روش در تعیین جنسیت برخی از پرندگان مورد آزمایش موفقیت آمیز نبود (11). همچنین در سال 2004، Agate و همکاران برای تعیین جنسیت Zebra Finches از ژن CHD1-Z و CHD1-W استفاده کردند (12). در این تحقیق با توجه به اینکه توالی ژنهای CHD-W و CHD-Z مربوط به قناری در بانک ژن جهانی ثبت نگردیده اند، لذا همان طور که در بالا اشاره شد، از روی توالی ژن CHD-W مربوط به پرنده ای شبیه به قناری، ترتیب نوکلئوتیدی پرایمرها انتخاب و نتایج مطلوبی در مورد تعیین جنسیت قناری بدست آمد. این سیستم تعیین جنسیت مولکولی بر اساس PCR که برای قناری ماده دو قطعه DNA و برای قناری نر، یک قطعه DNA تکثیر می نماید برای اولین بار تنظیم و معرفی می گردد.

[ ] [ ] [ مهرداد ]
Seri Sept جهت  درمان قارچ و جراحات پرنده
Serie پودر تقویت نطفه پرنده
Tetraseptol مایع ضد عفونی کننده قدرتمند جهت قفس و پرنده
Insectronis پودر نابود کننده شپش و کنه قناری
Calciolin درمان کننده بیماریهای کبد
Seri Pox درمان کننده زخم آبله داخلی و خارجی
غذای قناری شامل : غذای تخم مرغی + عسل + Cria
غذای قناری شامل : غذای تخم مرغی + عسل + Cria + رنگ قرمز
Vermicide داروي بر طرف كننده انگل پرندگان
Canto تشديد كننده حالت مستي در قناري
Muda دارويي مناسب براي دوران تولك قناري كه به پر سازي پرنده كمك ميكند
Sulfa داروي برطرف كننده ورم روده
Anti Stress برطرف كننده استرس پرندگان مخصوصا براي زمانهاي جابجايي
B-Complex محلول اشتها آور و تقويت كننده عمومي پرنده
Anti biotico درمان كننده اسهال سبز پرنده
Gentamacina برطرف كننده عفونت روده پرنده
Anti asmatico درمان كننده آسم پرنده
Calico محلول كلسيم براي پرنده مخصوص دوران تخم گذاري
AD3E تقويت كننده نطفه قناري
Total شامل كليه ويتامين هاي مورد نياز پرندگان زينتي
Pomade پماد بر طرف كننده شقاق پاي پرندگان زينتي
Cria دان مخصوص جوجه قناري
Tabernil پودر ضد شپش و كنه قناري
Asmoserin داروي ضد آسم قناري
Biosserin داروي تركيبي ضد ورم روده
Seridon داروي تركيبي درمان ورم روده شديد در پرندگان
Seri Band محلول برطرف كننده و ضد ويروس خارجي
Nekton B-complex تقويت كننده عمومي شامل ويتامينها ي مورد نياز، آرامبخش
Orlux (محصول بلژيك) پودر كلسيم
Ferivit Orlux (محصول بلژيك) تقويت كننده نطفه و ازدياد تخم در قناري
Cantax orlux تقويت كننده رنگ قرمز
Colombin (محصول بلژيك) اسپري ضد شپش
Vita Form (محصول تركيه) ازدياد كننده تخم در قناري
Avi Spray (محصول تركيه) اسپري ضد شپش
Opical 5 (محصول تركيه) پودر ضد شپش
Quiko goldy غذاي بلبل
Quiko BEO غذاي مينا
Quiko Parrot غذاي كاسكو
غذاي سرنگي Quiko غذاي سرنگي
Quiko Med داروي مخصوص درمان كليه ي  بيماريهاي گوارشي در پرندگان
ًQuiko MED Aqua داروي درمان بيماريهاي گوارشي
Quiko P تقويت كننده كبوتر
Bactazol ضد شپش و ضد عفوني كننده و از بين برنده باكتريهاي مضر
Fort مكمل غذايي
Plus مكمل غذايي
Quiko E تقويت كننده نطفه
Quiko Special غذاي تخم مرغي ويژه
Ardap اسپري از بين برنده شپش
Bioserine درمان كننده اسهال ، ورم روده و سرماخوردگي
Calci-lux تامين كننده كلسيم مورد نياز بدن پرنده
Insectornis پودر ضد شپش قابل استفاده در زمان آب تني پرنده
K-3 قابل استفاده براي درمان يبوست ، اسهال ، سرماخوردگي و بيماريهاي روده
Lutricyline درمان بيماريهاي تنفسي و تيفوس ، اسهال عفوني و مشكلات تناسلي
Nekton-M-S-A شامل مواد معدني ، اسيدهاي آمينه ، شلنيوم ، كلسيم و فسفات ميباشد . مورد استفاده جهت شكل گيري و استحكام استخوانها و تقويت نطفه
Nekton-Tonik-I يك مكمل غذايي كه شامل تمامي مواد غذايي ضروري براي پرنده ميباشد
Nekton-Bio ماده اي مقوي سرشار از پروتئين و 10 نوع ويتامين مهم و 6 نوع املاح معدني
Nekton-E جهت تقويت نطفه قناري
Nekton-Q مكمل غذايي شامل ويتامين هاي K-E-A
Nekton-S سرشار از ويتامين ، اسيد آمينه و سلنيوم جهت رشد
Quikon-forte سرشار از ويتامينهاي E و آهن و تامين كننده تمام ويتامينهاي مورد نياز براي زمان جوجه كشي و رشد جوجه هاي جوان
Quikon-Spirulina تقويت كننده سيستم دفاعي بدن ، پر رنگ كردن رنگ پرها ، رفع ريزش پر ، تقويت جوجه ها
Quiko-Adec قابل استفاده براي زمانهايي كه قناري ضعيف شده است. تقويت كننده استخوانهاي پرنده
Quikon-Bierhefe شامل ويتامينها و سفيده تخم مرغ ، موثر در افزايش توان جسمي و رشد بهتر جوجه ها
Quikon-Plus اين ماده تقويت كننده قابل استفاده براي جوجه هاي يكروزه تا انتهاي دوران تولك مي باشد و باعث تقويت سيستم ايمني بدن جوجه ها مي شود.
Quikon-badesalz استفاده از اين ماده باعث مي شود كه زمان تولك كوتاه شده و گرد و غبار پرها نيز برطرف شود
Ropa-B استفاده از اين ماده باعث مي شود كه زمان تولك كوتاه شده و گرد و غبار پرها نيز برطرف شود
SERINOL جهت پيشگيري و معالجه پرنده در مقابل باكتري و ويروس
Terramycin اين دارو به شكل پماد و محلول در آب مي باشد و براي درمان عفونتهاي چشمي و تسكين درد چشم ناشي از عفونت زخم قرنيه به كار ميرود
Vitacombex-V

جهت درمان بيماريهاي ناشي از كمبود ويتامين مانند نرمي استخوان و ضعف توان جنسي پرنده استفاده مي شود

 

[ ] [ ] [ مهرداد ]
سعی کنین که قناریهای روشن رو با هم جفت کنین. البته رنگهای تیره هم خواهان خاص خودشو داره. اما اونی که مهمه اینه که سعی کنین جوجه های تک رنگ به وجود بیارین. پس رنگهای تیره رو با رنگهای روشن قاطی نکنین.در حال حاضر رنگهای سرخ ،پرتقالی، طلایی و سفید طرفداران بیشتری داره . پس اگه کسی امکان انتخاب داره و هنوز قناری نخریده می تونه در مورد انتخاب رنگ دقت کنه و در صورتی که مایل باشه از این رنگها خریداری کنه.

اما در مورد زمان جفت کردن قناریها باید عرض کنم که تا زمانی که کاملا قناریها آماده نشدن اونها رو جفت نکنین.پیش می یاد که ماده آماده هست اما نر کاملا آماده نیست . در اون صورت احتمال نطفه نگرفتن تخمها زیاده . و ماده ممکنه از روی مستی تخم بذاره در حالیکه جفت گیری کامل صورت نگرفته.

در صورتیکه نر آماده باشه اما ماده آماده نباشه در این صورت نری که کنار ماده باشه و ماده آماده نباشه خراب می شه و از مستی می یفته. اونوقته که در فصل جفت گیری از اون نر هیچ منفعتی به دست نمی یارید.

وقتی دیدین که نر محکم می خونه و مستی نشون می ده قفس ماده رو نزدیک قفس نر گذاشته و بذارین صدای همدیگه رو بشنون اما همدیگه رو نبینن.

بعد از مدتی که گذشت و این شدت مستی نر وماده شدیدتر شد اونها رو روبروی هم بذارین که همدیگه رو ببینن.

این رو بدونین که قناری هم احساس داره. پس امکان اینکه نر و ماده از جفتی که شما براش انتخاب کردین خوشش نیاد . در این صورت با هم جفت نمی رن. پس بذارین مدتی کنار هم باشن و همدیگه رو ببینن. اگه باز مستی کردن و نسبت به هم واکنش نشون دادن اونوقته که می تونین اونها رو کنار هم بندازین.

معمولا در این زمان قناری ماده رو به قفس نر راهنمایی می کنن . اما به نظر می رسه که اگه نر رو وارد قفس ماده کنین بهتره . مدتی که طول می کشه تا اولین تخم گذاشته بشه بستگی به شدت آمادگی نر و ماده داره.

اونچه که مهمه اینه که از همون اول چال نذارین. این خیلی مهمه. چون اگه زود چال رو بذارین ماده می ره می خوابه و اگه خیلی آماده باشه از روی مستی تخم می ذاره واونوقت نطفه نمی گیره. علاوه بر اینکه از ابتدا که شروع به ساختن لونه می کنه تا زمان تخم گذاری چند بار چال رو می سازه و خراب می کنه . اونوقت موقعی که تخم می ذاره مشاهده می کنین که می ره تخمشو کنار چال می ذاره یا حتی می ره جای دیگه از قفس خارج چال می ذاره. این بدین خاطره که قناری موقعی که زمان تخم گذاریش نزدیک می شه شروع به درست کردن لونه می کنه. پس باید بدونین که قناری کی جفت رفته تا زمان تخمینی تخم گذاشتنش رو حدس بزنین. سه روز قبل از اینکه تخم بذاره چال رو براش بذارین تا بره و لونه خودش رو بسازه. ماده زمانی که می خواد تخم بذاره پشتش ورم می کنه و حالت اون عوض می شه سنگین حرکت می کنه و فضله اون آبکی می شه. در این زمان دادن مقداری برگ کاهو برای راحت گذاشتن تخم مفیده. وقتی اولین تخم رو گذاشت اون رو بردارین و جاش چیزی مثه تخم بذارین. (این کار رو به آرامی و بدون ایجاد وحشت انجام دهید) و همین طور تا آخرین تخم همین کار رو بکنین .وقتی تخم آخر رو گذاشت همه تخمها رو یه جا بذارین زیر پای قناری تا اینکه جوجه ها با هم در بیان.

جوجه قناری در روزهای اول خیلی سریع رشد می کنه واسه همین هم جوجه هایی که با فاصله دو یا سه روز از تخم در می یاد امکان داره زیر پای جوجه های قبلی له شن و ازتغذیه شدن کمتری هم برخودارن. چون جوجه های بزرگتر اجازه نمی دن ماده به جوجه های کوچکتر غذا بده .پس در اومدن با هم خیلی مهمه.

به ندرت تخمهای چهارم به بعد نطفه داره. پس اگه قناری شما بیشتر از 4 تخم می ذاره احتمال در اومدن بیش از 4 جوجه بعیده. اگه بتونین این ریسک رو بپذیرین واسه اینکه ماده بتونه خوب تخمها رو نگه داره و بگردونه بیشتر از 4 تخم زیر پاش نذارین . یعنی تخمهای چهارم به بعد رو کنار بذارین.

وقتی ماده رو تخم خوابیده و نر در قفس ماده هست امکان داره به تخم خوری عادت کنن. پس هرازگاهی مقدار کمی غذای تخم مرغی برای اونها بذارین که تخمهای خودشون رو نخورن.

معمولا ماده های جوان در نگه داری جوجه ناشی هستن. پس اگه می خوان تا حدودی از ماده خودتون خیالتون راحت باشه ماده ای بخرین که یه فصل جوجه کشی رو طی کرده باشه .

اما برعکس اون نر باید جوان باشه. چون نر باید دارای نطفه باشه. معمولا قناریهای دارای سن بالا نطفه ضعیف دارن. مخصوصا که تغذیه خوبی هم نداشته باشه.

پس نر جوان و ماده با تجربه خریداری کنین. ماده جوان رو می تونین از ماده کارکرده به خوبی تشخیص بدین. ماده ای که قبلا تخم گذاشته از پشت اون کاملا معلومه. وبرآمده است اما ماده ای که تا به حال تخم نذاشته پس اون خشکه . یعنی حالت برآمدگی چندانی نداره.

اما نکته ای رو قبلا گفته بودم که اگه کسی صبر کنه و جوجه هاشو بعد عید بگیره خیلی بهتره. من بر نظر خودم پافشاری می کنم. اما این بدین معنا نیست که اگه قناریاتون آماده هستن اونها رو جفت نکنین . چون در این صورت از مستی می یفتن. و می رن تو پرریزی. اما اگه بتونین طوری قناریاتون رو نگه داری کنین که نزدیکای عید آماده جفت شن این خیلی بهتره.

اینطور که نرها رو در یه قفس و ماده ها رو هم در یه قفس دیگه نگه دارین. و نذارین که چراغ توی اتاق تا دیروقت روشن باشه. اگه قناریهای با رنگ روشن دارین سعی کنین در جایی که نور شدید نداره نگه داری کنین.و از دادن دانه هایی که باعث مستی می شه پرهیز کنین.
براي جفتگیری و جوجه كشي مناسب از قناری به نكات ذیل توجه نماييد :

۱- قناری نر و ماده باید کاملاً آماده باشند .
۲- قناری نر به قفس قناری ماده هدایت شود.
۳- محیطی آرام و به دور از رفت و آمدهای غیر ضروری برای جفتها فراهم شود.
۴- دو ماه قبل از جفتگیری قناریها تحت رژیم غذایی مناسب قرار گیرند تا جوجه های سالم و قوی بدهند و و خودشان نیز در این دوران بیش از حد ضعیف نشوند.
۵- دو قناري كه داراي عيب مشترك می باشند نبايد با يكديگر جفت شوند.
۶- از نظر جثه بايد هر دو يا يكي از جفتها داراي اندامي قابل ملاحظه باشد.
۷- برای جفتگیری از دو قناری با رنگهای مخالف یا متباین استفاده شود.
۸- قناریها باید کاملاً سالم و قوی باشند و اثری از کسالت و بیماری در آنها نباشد.
۹- دمای محیط برای جفتگیری بین 21 تا25 درجه سانتیگراد باشد.
۱۰- بهترين موقع براي جفت كردن قناريها نیمه فروردين ماه است و حتي الامكان از اسفند ماه نبايد زودتر جفتگیری انجام شود. اما اگر درجه حرارت اتاق قناريها ثابت باشد و آمادگي قناريها براي جفت گيري زیاد باشد بايد هر چند روز هم از موعد جفت گيري زودتر باشد ، از اين عمل جلوگيري ننمود چون باعث خراب شدن و تولک رفتن قناری می شود.
۱۱- پرنده هايي را براي جفت انداختن انتخاب كنند كه در رده هاي مختلف سني قرار دارند. يك نر جوان را با ماده اي كه يكسال دارد در و يا بر عكس جفت کنید .
۱۲- در حد امکان یکی از جفتها تجربه یک دوره جفتگیری موفق را داشته باشد.در صورت امکان از قناری ماده ای که سابقه بزرگ کردن جوجه را دارد استفاده کنید .
۱۳- مصرف برگ کاهو در زمان جفتگیری فراموش نشود.
۱۴- لانه تخمگذاری را روزچهارم یا پنجم در قفس بگذارید چون ممکن است قناری ماده تا زمان تخمگذاری چند بار لانه را بسازد و خراب کند و در نهایت خسته شده و لانه مناسبی نسازد و یا اینکه تخم بدون نطفه بگذارد.
۱۵- هفته اییک بار و به مقدار کم هفت تخم در ظرف شصتی در اختیار جفتها و جوجه هایشان قرار گیرد.
۱۶- وقتی قناری ماده تخم گذاشت هر چه زودتر و به آرامی آنرا با تخم مصنوعی یا تخم بدون نطفه یا فاسد شده عوض کنید واین کار را تا آخرین تخم تکرار کنید وقتی قناری آخرین تخم را گذاشت تخمهای اصلی را به زیر قناری ماده برگردانید تا جوجه ها در فاصله زمانی کوتاهی ازهم متولد شوند.
۱۷- هفته ای دو بار غذای تخم مرغی دراختیار جفتها قرارگیرد و به محض تولد جوجه ها هر روز از غذای تخم مرغی استفاده شود.
۱۸- از قناری خوش آواز جهت آموزش جوجه ها استفاده شود تا قناریهای خوش آوازی تکثیر شوند.
۱۹- از داروهای تقویتی این دوره به طور صحیح استفاده گردد.
[ ] [ ] [ مهرداد ]
 
canary11.jpg


اصول‌ نگهداري‌ از قناري‌

خريد قناري

در وحله اول بايد دانست هدف شما از خريد قناري چيست؟ اگر به خاطر آواز و صدايش باشد قناري مورد نظر شما در دسته قناريهاي آوازي (song canary) قرار دارد اگر به خاطر رنگش قصد خريد داريد ، قناري مورد نظر شما در ضمره قناريهاي رنگين (colour canary) قرار دارد .
در كل اگر قصد خريد قناري داريد ، ابتدا بايد به چند نكته توجه داشته باشيد :

canary1.jpg


- قناري انتخابي شما از لحاظ ظاهري بايد داراي شرايط زير باشد :
- پرهاي صاف و نرم وشفاف .
- چشماني نافذ ،آگاه و روشن .
- داشتن حالت سرزندگي و شادابي و تحرك .
- پاهاي صاف و انگشتان سالم بدون داشتن شقاق و فلس پا(نوعي قارچ پوستي ميباشد به رنگ سفيد كم رنگ كه در نتيجه آلودگي قفس پرنده به وجود مي آيد - فلس دار بودن پاي پرنده نيز گوياي نرسيدن ويتامين مخصوصا كلسيم به بدن قناري مي باشد).
- خالي نبودن (حتي يك نقطه از) بدن از پر مخصوصا قسمت سر و گردن .
- استوار ايستادن پرنده روي پاهايش .
- اطمينان به عادي بودن صداي تنفس پرنده مخصوصا در هنگام تحرك .
- پف آلود نبودن (كز نبودن) پرنده .

canary5.gif


قفس و لوارم جانبی

۱- حتي المقدور سعي كنيد از قفسهاي تمام استيل براي نگهداري قناري استفاده كنيد.

۲- از ميله هاي پلاستيكي درون قفس استفاده كنيد.

۳-  هفته اي ۱يا ۲ بار كف قفس را  تميز كنيد.

۴- از قرار دادن وسائل تزئيني اضافي در قفس جدا خودداري كنيد.

۵- هر ماه يكبار قفس را با محلولهاي ضد عفوني ، استريل كنيد.

۶- دانه خوري و آبخوري را هر ۲ هفته ۱ بار تميز كنيد.

۷- از گذاشتن تجهيزات شكسته درون قفس خودداري كنيد.(چون باعث زخم شدن پاي پرنده ميشود).

۸- در هنگام جفت اندازي قناري ، هر روز آبخوري پرنده را چك كنيد كه خالي نباشد . مخصوصا اگر از پنبه براي درست كردن  چال استفاده كرده ايد. توصيه من اين است كه از ابر براي درست كردن چال استفاده كنيد و كمي پنبه وسط آن قرار دهيد. 

canary9.jpg


فضای محیط نگهداری

دماي محيط نگهداري پرنده بايد بين ۲۰ تا ۲۵ درجه سانتي گراد باشد.(البته دوستان توجه داشته باشند كه دما نبايد مرتب افت و خيز داشته باشد ، يعني هر چه دماي محيط ثابت باشد بهتر است). در كل ميتوان گفت دماي محيطي كه ما براي فضاي زندگيمان انتخاب ميكنيم ،(كه اين دماي متعادلي است) براي محيط زندگي اين پرنده مناسب است.

اگر بتوانيد حداقل روزي ۱ بار به مدت ۱۵ تا ۳۰ دقيقه قناري را  روبروي آفتاب ملايم قرار دهيد و حتي اگر شرايط جوي مناسب بود وان مخصوص آبتني قناري  را (در تابستان هفته اي دو بار و در زمستان هفته اي يك بار) در اختيارش بگزاريد تا  آب بازي(حمام) كند.

canary12.jpg


آب تنی

قناری های آزاد در طبیعت دوست دارند که بر روی چمن های مرطوب غلت بزنند و بدین ترتیب خودشان را تمیز کنند. در برخی از موارد به علت طولانی شدن فواصل بین آب تنی ممکن است برخی از پرنده ها میل به آب تنی را از دست بدهند و یا جوجه هایی که برای اولین بار با ظرف آب تنی آشنا می شوند ممکن است رغبتی به این کار نشان ندهند. اما کلا آب تنی خصوصا در فصول گرم سال و هنگام پر ریزی بسیار ضروری است. چرا که موجب تحریک رشد سریع پرهای جدید می گردد. آب تنی پرنده ماده در اواخر دوران خوابیدن بر روی تخم ها باعث مرطوب شدن سطح پوسته آن شده و ضمن کاهش از دست رفتن آب موجب خروج راحت تر جوجه از تخم می گردد. بعد از استحمام پرنده به آراستن خود می پردازد. پرهای خود را پوش داده می لرزاند و با نوک خود آنها را مرتب می کند. سپس به کمک منقارش مواد چربی مترشحه از غده خاصی که در بالای محل اتصال دم به بدنش قرار دارد و اوروپیژیال (Uropygial) نامیده می شود را روی کلیه پرهایش می مالد. این روغن باعث براقی پرهای قناری شده و به عنوان یک ماده محافظ طبیعی عمل می کند. بعضی از پرنده های دست آموز عادت به استحمام در زیر شیر آب ظرفشویی آشپزخانه دارند و از ریزش جریان آب بر روی بدنشان بسیار لذت می برند. از اینرو بسیار طبیعی است که با شنیدن صدای جریان آب به سوی ظرفشویی پرواز کنند. یکی از راه ها آشنا کردن پرندگان با ظرف آب تنی گذاشتن برگ کاهوی مرطوب در کف قفس است تا پرنده خود را بر روی آن مالیده و پر و بالش را تمیز نماید. راه دیگر گذاشتن یک قطعه یخ بر روی قفس و قرار دادن ظرف آب تنی (با مقدار کمی آب) در زیر آن بر روی کف قفس است تا با آب شدن یخ و چکیدن قطرات آب پرنده نسبت به آب تنی تحریک شود. همچنین می توان ظرفی حاوی آب با درجه حرارتی حدود دمای اتاق و با عمقی کم به طوری که پرنده بتواند داخل آن آب تنی کند کف قفس قرار داده تا پرنده درون آن استحمام نماید. پس از استحمام به علت ریختن آب بر روی کف قفس خشک کردن و یا تعویض پوشش کف آن ضروری می باشد.


 

نتيجه حاصل را خودتان مشاهده ميكنيد. (صافي و روشني پرها - سلامت و شادابي پرنده - زودتر آماده شده پرنده براي جفت گيري - آلوده نشدن به بيماريها و ... از مزيتهاي اين كار است  ).



نكته:

توجه كنيد كه از آب بازي دادن پرنده در روزهاي سرد و روزهائي كه باد مي آيد ( كه موجب ميشود پرنده سرما بخورد ) خودداري كنيد . و اين عمل بايد درون اتاق و پشت پنجره انجام شود.

جیره غذایی

جيره غذائي بايد متناسب با موقعيت نگهداري قناري باشد:

دان مخصوص قناري تخم كتان است. كه در تمام فصول سال غذاي عمده پرنده را تشكيل ميدهد . بهتر آن است كه به ازاي هر ۱ كيلو تخم كتان نيم كيلو ارزن ريز اضافه كنيم.
در فصل سرما ميتوانيد ، به ازاي هر ۱ كيلو تخم كتان و نيم كيلو ارزن ، ۱۰۰ گرم  تخم كلم،  تخم شلغم،  خص دانه،  تخم كاهو و تخم خلفه . شاهدانه و تخم گشنيز اضافه كنيد.

در تابستان نيز همان مخلوط كتان و ارزن و در كنارش تخم خلفه را مناسب ميدانم. سعي كنيد در تابستان از رژيم غذائي خنك استفاده كنيد.(مثلا كاهو - اسفناج - خيار سبز - ته پوست هندوانه ،‌سيب به مقدار مختصر و ...).

 

[ ] [ ] [ مهرداد ]

.: Weblog Themes By Iran Skin :.

درباره وبلاگ

با سلام دوستان برای خرید با شماره 09388444133 تماس بگیرید در صورت عدم جوابگویی پیامک بزنید(در حال حاضر به سوالات رسیدگی نمیشود لطفا سوالی در سایت و با استفاده از شماره نفرمایید)باتشکر
آرشيو مطالب
امکانات وب